Review



pcr conditions  (Eppendorf AG)


Bioz Verified Symbol Eppendorf AG is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Eppendorf AG pcr conditions
    Pcr Conditions, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 97/100, based on 1182 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/pm40669350-104-14-16?v=Eppendorf+AG
    Average 97 stars, based on 1182 article reviews
    pcr conditions - by Bioz Stars, 2026-08
    97/100 stars

    Images



    Similar Products

    pcr condition  (Jackson Laboratory)
    86
    Jackson Laboratory pcr condition
    Pcr Condition, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/pm41760646-264-28-31?v=Jackson+Laboratory
    Average 86 stars, based on 1 article reviews
    pcr condition - by Bioz Stars, 2026-08
    86/100 stars
    		  Buy from Supplier
    pcr conditions  (New England Biolabs)
    99
    New England Biolabs pcr conditions
    Pcr Conditions, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/pmc12733218-95-26-23?v=New+England+Biolabs
    Average 99 stars, based on 1 article reviews
    pcr conditions - by Bioz Stars, 2026-08
    99/100 stars
    		  Buy from Supplier
    standard oligo pool pcr condition  (Twist Bioscience)
    86
    Twist Bioscience standard oligo pool pcr condition
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Standard Oligo Pool Pcr Condition, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/pmc12526118-76-2-12?v=Twist+Bioscience
    Average 86 stars, based on 1 article reviews
    standard oligo pool pcr condition - by Bioz Stars, 2026-08
    86/100 stars
    		  Buy from Supplier
    pcr thermal cycling conditions  (Bio-Rad)
    99
    Bio-Rad pcr thermal cycling conditions
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Pcr Thermal Cycling Conditions, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/pm41009624-263-1-8?v=Bio-Rad
    Average 99 stars, based on 1 article reviews
    pcr thermal cycling conditions - by Bioz Stars, 2026-08
    99/100 stars
    		  Buy from Supplier
    paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc  (Jackson Laboratory)
    86
    Jackson Laboratory paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Paper N A Kras G12d Conditional Pcr Primer 1 Gtctttccccagcacagtgc, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/pm40712568-356-209-218?v=Jackson+Laboratory
    Average 86 stars, based on 1 article reviews
    paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc - by Bioz Stars, 2026-08
    86/100 stars
    		  Buy from Supplier
    pcr conditions  (Eppendorf AG)
    97
    Eppendorf AG pcr conditions
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Pcr Conditions, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/pm40669350-104-14-16?v=Eppendorf+AG
    Average 97 stars, based on 1 article reviews
    pcr conditions - by Bioz Stars, 2026-08
    97/100 stars
    		  Buy from Supplier
    pcr conditions  (Jackson Laboratory)
    90
    Jackson Laboratory pcr conditions
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Pcr Conditions, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/pm40663455-292-0-10?v=Jackson+Laboratory
    Average 90 stars, based on 1 article reviews
    pcr conditions - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    pcr cycling conditions  (BGI Shenzhen)
    90
    BGI Shenzhen pcr cycling conditions
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Pcr Cycling Conditions, supplied by BGI Shenzhen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/pm40597612-95-1-45?v=BGI+Shenzhen
    Average 90 stars, based on 1 article reviews
    pcr cycling conditions - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR oligo pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).

    Journal: Nucleic Acids Research

    Article Title: A versatile platform for combinatorial antibody library cloning and NGS-based quality control with high accuracy

    doi: 10.1093/nar/gkaf1001

    Figure Lengend Snippet: Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR oligo pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).

    Article Snippet: Additionally, a standard oligo pool PCR condition was included for comparison, following Twist Bioscience’s oligo pool PCR protocol (10 ng of oligo pool in a 25 μl PCR reaction, 10 cycles).

    Techniques: Cloning, Biomarker Discovery, Plasmid Preparation, Sequencing